R E C I P E S

II. Polymerase Chain Reaction

1% Cresol Red Dye

Makes 50 ml. Store at room temperature.

  1. Add 500 mg to 50 ml of distilled water in a 50-ml tube.
  2. Shake tube to dissolve.

Cresol Red Loading Dye

Makes 50 ml. Store at 4░ C.

  1. Add 17 g of sucrose to 49 ml of distilled water in a 50-ml tube.
  2. Shake tube to dissolve
  3. Add 1 ml of 1% cresol red dye.
  4. Shake tube to mix.

PV-92 Primer/Loading Dye Mix

Makes for 50 PCR reactions. Store in freezer for 1 year.

640 Ál of distilled water
460 Ál of Cresol Red Loading Dye
19 Ál of 5' primer [15 pm/Ál]
19 Ál of 3' primer [15 pm/Ál]
Vortex to mix.

PV-92 Primer Sequences

Forward primer: 5' GGATCTCAGGGTGGGTGGCAATGCT 3'
Reverse primer: 5' GAAAGGCAAGCTACCAGAAGCCCCAA 3'



A L U  I N S E R T I O N  P O L Y M O R P H I S M

DNA Learning Center, Cold Spring Harbor Laboratory
Noncommercial, educational use only.
Kits available from Carolina Biological Supply Company.